Configure Image - Genome Browser V478
 
Image width:pixels
Label area width:characters
Text size:
Font:
Style:
Tooltip text size:
Maximum track load time: seconds
Display chromosome ideogram above main graphic
Show light blue vertical guidelines, or light red vertical window separators in multi-region view
Display labels to the left of items in tracks
Display description above each track
Show track controls under main graphic
Next/previous item navigation
Next/previous exon navigation
Show exon numbers
Show move left/right limit buttons under image
Enable highlight with drag-and-select (if unchecked, drag-and-select always zooms to selection)
Enable pop-up when clicking items

Configure Tracks on UCSC Genome Browser: C. elegans Feb. 2013 (WBcel235/ce11)
  Tracks:    Groups:
Control track and group visibility more selectively below.
-   Mapping and Sequencing    
Base Position Chromosome position in bases. (Clicks here zoom in 3x)
Assembly Assembly from Fragments
Gap Gap Locations
GC Percent GC Percent in 5-Base Windows
INSDC Accession at INSDC - International Nucleotide Sequence Database Collaboration
RefSeq Acc RefSeq Accession
Restr Enzymes Restriction Enzymes from REBASE
Short Match Perfect Matches to Short Sequence (CAGCAGCAGCAGCAGCAGCAG)
-   Genes and Gene Predictions    
NCBI RefSeq RefSeq genes from NCBI
WS245 Genes Gene predictions from WormBase WS245 release
AUGUSTUS AUGUSTUS ab initio gene predictions v3.1
CRISPR CRISPR/Cas9 Sp. Pyog. target sites
     CRISPR Targets     CRISPR/Cas9 -NGG Targets
     CRISPR Regions     Genome regions processed to find CRISPR/Cas9 target sites (exons +/- 200 bp)
Ensembl Genes Ensembl Genes
Genscan Genes Genscan Gene Predictions
Other RefSeq Non-C. elegans RefSeq Genes
-   mRNA and EST    
Spliced ESTs C. elegans ESTs That Have Been Spliced
C. elegans ESTs C. elegans ESTs Including Unspliced
C. elegans mRNAs C. elegans mRNAs from GenBank
Other mRNAs Non-C. elegans mRNAs from GenBank
-   Expression and Regulation    
CpG Islands CpG Islands (Islands < 300 Bases are Light Green)
     Unmasked CpG     CpG Islands on All Sequence (Islands < 300 Bases are Light Green)
     CpG Islands     CpG Islands (Islands < 300 Bases are Light Green)
-   Comparative Genomics    
Conservation Nematode Multiz Alignment & Conservation (26 Species)
Cons 135 species Multiz Alignment & Conservation (135 species: 112 nematodes, 22 flatworms and Ciona intestinalis)
Nematodes Chain/Net Nematodes Chain and Net Alignments
-   Variation and Repeats    
Interrupted Rpts Fragments of Interrupted Repeats Joined by RepeatMasker ID
Simple Repeats Simple Tandem Repeats by TRF
WM + SDust Genomic Intervals Masked by WindowMasker + SDust
RepeatMasker Repeating Elements by RepeatMasker
Self Chain C. elegans Chained Self Alignments